Labo intégré en sciences de la vie I

BIO-203

COMPLETE Benchling Exercises 1+2 of Lab 3

This page is part of the content downloaded from COMPLETE Benchling Exercises 1+2 of Lab 3 on Sunday, 25 January 2026, 04:24. Note that some content and any files larger than 50 MB are not downloaded.

Description

Walk-in support sessions for Benchling Exercises

Tuesday 14.10 14:15-15:00 DIA 004
Friday 17.10 14:15-15:00 CO 121
Tuesday 28.10 14:15-15:00 DIA 004
Friday 31.10 14:15-15:00 CO 121


To learn the basics of virtual cloning, complete Benchling exercise 1 and 2 using this step-by-step manual (download as pdf) and sequences attached below. In real life you would do the primer design prior to the PCR, here you may start while the sample is in the thermocycler. Since there are many new concepts the exercise is designed to gradually increase in difficulty and autonomy: 

  • exercise 1: as shown in manual
  • exercise 2: same steps as exercise 1, now with different sequences
  • finally, as recap and to understand the big picture: put screenshots of the main steps in SLIMS. Do not attempt to do screenshots in parallel, it will dissipate your attention and you miss out on the recap.


Exercise 1 primers

  • Mm-Amy2_for: CAGGATCCACCATGAAGTTCGTTCTGCTGCTTTC
  • Mm-Amy2_rev: GGCTCGAGTTCATACAATTTTGAGTCAGCATGGATTG

Exercise 1 vector sequence pcDNA6/myc-His A


Exercise 2 primers

  • Mm_Amy2_HindIII_F: CGAAGCTTACCATGAAGTTCGTTCTGCTGCTTTC
  • Mm_Amy2_NotI_R: ATGCGGCCGCCCATACAATTTTGAGTCAGCATGGATTGC

Exercise 2 vector sequence pcDNA6/myc-His B


Files and subfolders